SpinVac to dryness and resuspend pellet in 20 µl H20
2 µl DNA solution.
10 mM Tris-HCl (9.0)
75 mM KCl
3.5 mM MgCl2
0.1% Triton X-100
0.2 mM dATP, dCTD, dGTD, dTTP
20 pmol S-121 and S-122 primers
1.0 unit Taq polymerase
Add water to final vol of 20 ml
5’ at 95oC
35 cycles 95o C- l min, 65o C - 1 min, 72o C - 1 min.
Analyze 5 µl on 6% acrylamide/7M urea gel.
Visualize by staining with silver.
Ethanol-precipitate the PCR products, Spin-Vac dry, and resuspend in 20 µl TE (10 mM Tris-HCl, pH 7.9, 0.1 mM EDTA).
Gel electrophoresis of 10µl DNA + 2 µl loading buffer.
For 83 bp and 122 bp products, use a 4% gel (3:1 Nusieve agarose).
For 330 bp product, use a 2% agarose gel.
Can also do Slot Blot hybridization on Nylon membrane.
Hybridization
For 122 bp product use S33 A as a probe
For 330 bp product use S67 as a probe
a). set a heating block to 95oC. Heat the oligo to 95oC for 5 minutes to denature any H-bonds. Put on ice immediately to stop reannealing.
b). Add to a 0.6 ml Eppendorf tube the following:
Terminal Transferase buffer 4µl
CoCl2 solution 6 µl
dATP (100 mM) 1µl
Digoxigenin-11-dUTP (mM) 2.5 µl
Oligonucleotide (300 ng/ml) 1 µl
Terminal Transferase 1 µl
DdH2O to 20 ml 4.5 µl
NB: The Terminal Transferase buffer and CoCl2 solution are supplied with the Terminal Transferase kit.
c). Incubate at 37oC for 10 minutes.
d). Heat to 95oC for 5 minutes, to denature the enzyme. Place on ice immediately.
e). This can either be added directly to the hybridization, or stored at -20·C. If stored, the probe should be heated to 95oC again just prior to use.
5.Add the probe to the pre-hybridizing filters, and hybridize overnight at 37o C.
6.Next day, wash 3 x 15 minutes in 6 x SSC/0.1% SDS at 37oC. Prewarm the solution to 65oC before adding it to the filters.
7.Wash 1 X 10 minutes in Me4NC1 buffer at 37oC. Prewarm the solution to 65oC before adding it to the filters.
8.Wash 2 x 30 minutes in Me4NC1 buffer at 65oC. Do this with shaking. Have the solution at 65oC.
9. Wash 3 x 10 minutes in Genius Buffer #1, with shaking at room temperature.
10. Add 50 ml Genius Buffer #2 and leave at room temperature at least 2 hours. Can leave filters in Buffer #2 overnight if desired.
11. Add 10 ml Anti-Digoxigenin-AP to the Genius Buffer #2 on the filters and mix well. Leave on a shaker at room temperature for 30 minutes.
12. Wash 2 x 15 minutes in Genius Buffer #1, with shaking at room temperature.
13. Wash 1 x 10 minutes in Genius Buffer #3, with shaking at room temperature.
14. Dilute the Lumi-Phos 530 1:3 in Genius Buffer #3 (30 mls GB #3 and 15 mls Lumi-Phos). Lumi-Phos is light sensitive so work with it in a darkened room. Briefly wet the filter with the diluted Lumi-Phos in a dish, and drain any excess from the filter. Place the filter on a glass plate covered with plastic wrap (no bubbles), with the DNA side facing up. Cover the filter with another piece of plastic wrap, making sure there are no bubbles between the plastic and the filter, still working in relative darkness. The Lumi-Phos can be re-used 5 – 20 times, or until it is no longer giving a good signal.
9. Place the glass plate with filter in an X-ray cassette and place at 37o C for 30-40 minutes.
10. Expose the filter to X-ray film, and develop in 15-30 minutes. Sometimes a longer exposure is required (2-3 hours).
330 bp variable region
Primers: S35 5’-AAATAATGTACGGG(T/G)GAGATGCAT GA-3’
S36 5’-GGGTTCGATTGGGGTTGGTGT-3’
S-121 5’–AAATAATGTACGGG(T/G)GAGATGCATGA-3’
S-122 5’–GGTTCGATTGGGGTTGGTGTAATATA-3’
122 BP conserved region
Primers: S67 TGGTTTTGGGAGGGG(C/G)(G/C)(T/G)TCAA(A/C)TTT-3’
SG TGGTTTTGGGAGGGGCGTTCAAATTT-3’ (If 121/122 are used for PCR, this probe can be used to detect the 300 bp fragment.
S34A TATATTACACCAACCCCAATCGAACC-3’
83 bp conserved region
Primers S33A TCATCGATCTC(C/A)CCCGTACATTATTT
S34A TATATTACACCAACCCCAATCGAACC
10 X Primers (10 mM of each primer, 20 mM total)
i) 330 bp variable region
Primers: S35 172 µg
S36 138 µg
Bring volume up to 2 ml with sterile ddH2O
ii) 122 bp conserved region
Primers: S67 172 µg
S34A 172 µg
SG 172 µg
Bring volume up to 2 ml with sterile ddH2O
iii) 83 bp conserved region
Primers: S33A 172 µg
S34A 172 µg
Bring volume up to 2 ml with sterile ddH2O
Store solutions in 200 µl aliquots at -80oC.
10 x dNTP’s (10 mM dNTP’s, 2.5 mM of each)
100 mM dATP 100µl
100 mM dCTP 100µl
100 mM dTGP 100µl
100 mM dTTP 100µl
(100 mM dUTP 100µl *)
sterile ddH2O 3600 µl
*Substitution of dUTP for dTTP can be made for use with Uracil DNA Glycosylase to prevent future contamination with amplified products.
Store in 200 µl aliquots at -80oC.
| Description |
Company |
Cat. Number |
Price |
| 1. Magna NT Nylon Membrane, 0.45 Micron 30 cm x 3 m roll |
Transfer Micron Separations, Inc. |
NT4HY00010 |
$181.90 |
| 2. Salmon Sperm DNA |
Sigma |
D1626 |
$26.75 |
| 1.Tetramethylammonium Chloride |
Fisher |
04640-500 |
500g/ $42.80 |
| 4. Digoxigenin-11-dUTP |
Boehringer Mannheim |
1093 088 |
25ml $122.00 |
| 5. Terminal Transferase Kit |
Boehringer Mannheim |
220 582 |
500m/ $92.00 |
| 6. Blocking Reagent |
Boehringer Manheim |
1096176 |
50 gm/ $75.00 |
| 7. Anti-Digoxigenin AP Fab Fragments |
Boehringer Mannheim |
1093 274 |
150m/ $104.00 |
| 8. Lumi-Phos 530 |
Boehringer Mannheim |
1275 470 |
100ml/$262.00 |
Hybridization Buffer
6 x SSC
1 x Denhardt’s
1% SDS
100 µg/ml Salmon Sperm DNA
0.05 mg/ml Sodium Pyrophosphate
Tetramethylammonium Chloride (Me4NC1) Buffer
Make a 5 M stock solution of Me4NC1, determine molarity from the refractive index (n) by the formula c=(n – 1.221)/0.018
3 M Me4NC1
50 mM Tris HC1 (pH8)
2 mM EDTA
1% SDS
6 x SSC / 0.1% SDS (500 mls)
150 ml of 20 x SC
5 ml of 10% SDS
345 ml ddH2O
Genius Buffer #1 (1 litre)
100 ml 1 M Tris-HC1 pH 7.5
30 ml 5 M NaCl
870 ml ddH2O
Genius Buffer #2
500 ml Genius Buffer #1
10 g Blocking Reagent
Mix well and dissolve at 65oC. Shake intermittently until dissolved. Store at 4oC.
Genius Buffer #3 (500 mls)
25 ml 1M MgCl2
50 ml 1M Tris-HC1 (pH 9.5)
10 ml 5M NaC1
415 ml ddH2O
Carriazo, C.S., Sembaj, A., Aguerri, A.M., Requena, J.M., Alonso, C., B?a, J., Ruiz, A., Segura, E., and Barral, J.M. (1998). Polymerase chain reaction procedure to detect Trypanosoma cruzi in blood samples from chronic chagasic patients. Diagn.Microbiol.Infect.Dis. 30, 183-186.
Gomes, M.L., Macedo, A.M., Vago, A.R., Pena, S.D., Galvao, L.M., and Chiari, E. (1998). Trypanosoma cruzi: Optimization of polymerase chain reaction for detection in human blood. Exp.Parasitol. 88, 28-33.
Olivares-Villag?mez, D., McCurley, T.L., Vnencak-Jones, C.L., Correa-Oliveira, R., Colley, D.G., and Carter, C.E. (1998). Polymerase chain reaction amplification of three different Trypanosoma cruzi DNA sequences from human chagasic cardiac tissue. Am.J.Trop.Med.Hyg. 59, 563-570.
Lane, J.E., Olivares-Villagomez, D., Vnencak-Jones, C.L., McCurley, T.L., and Carter, C.E. (1997). Detection of Trypanosoma cruzi with the polymerase chain reaction and in situ hybridization in infected murine cardiac tissue. Am.J.Trop.Med.Hyg. 56, 588-595.
Oury, B., Dutrait, N., Bastrenta, B., and Tibayrenc, M. (1997). Trypanosoma cruzi: Evaluation of a RAPD synapomorphic fragment as a species-specific DNA probe. J.Parasitol. 83, 52-57.
Espinoza, A.G., Taibi, A., Billaut-Mulot, O., and Ouaissi, A. (1996). PCR-based detection of Trypanosoma cruzi useful for specific diagnosis of human Chagas' disease. J.Clin.Microbiol. 34, 485-486.
Russomando, G., De Arias, A.R., Almiron, M., Figueredo, A., Ferreira, M.E., and Morita, K. (1996). Trypanosoma cruzi: Polymerase chain reaction-based detection in dried feces of Triatoma infestans. Exp.Parasitol. 83, 62-66. Shikanai-Yasuda, M.A., Ochs, D.E., Tolezano, J.E., and Kirchhoff, L.V. (1996). Use of the polymerase chain reaction for detecting Trypanosoma cruzi in triatomine vectors. Trans.R.Soc.Trop.Med.Hyg. 90, 649-651.
Vago, A.R., Macedo, A.M., Adad, S.J., Reis, D.D., and Correa-Oliveira, R. (1996). PCR detection of Trypanosoma cruzi DNA in oesophageal tissues of patients with chronic digestive Chagas' disease. Lancet 348, 891-892.
Vago, A.R., Macedo, A.M., Oliveira, R.P., Andrade, L.O., Chiari, E., Galvao, L.M.C., Reis, D.D., Pereira, M.E.S., Simpson, A.J.G., Tostes, S., and Pena, S.D.J. (1996). Kinetoplast DNA signatures of Trypanosoma cruzi strains obtained directly from infected tissues. Am.J.Pathol. 149, 2153-2159.
Britto, C., Cardoso, M.A., Monteiro Vanni, C.M., Hasslocher-Moreno, A., Xavier, S.S., Oelemann, W., Santoro, A., Pirmez, C., Morel, C.M., and Wincker, P. (1995). Polymerase chain reaction detection of Trypanosoma cruzi in human blood samples as a tool for diagnosis and treatment evaluation. Parasitology 110, 241-247.
Britto, C., Cardoso, M.A., Ravel, C., Santoro, A., Pereira, J.B., Coura, J.R., Morel, C.M., and Wincker, P. (1995). Trypanosoma cruzi: Parasite detection and strain discrimination in chronic chagasic patients from northeastern Brazil using PCR amplification of kinetoplast DNA and nonradioactive hybridization. Exp.Parasitol. 81, 462-471.
Gonzalez, N., Galindo, I., Guevara, P., Novak, E., Scorza, J.V., Anez, N., Da Silveira, J.F., and Ramirez, J.L. (1994). Identification and detection of Trypanosoma cruzi by using a DNA amplification fingerprint obtained from the ribosomal intergenic spacer. J.Clin.Microbiol. 32, 153-158.
Wincker, P., Bosseno, M.-F., Britto, C., Yaksic, N., Cardoso, M.A., Morel, C.M., and Breni?re, S.F. (1994). High correlation between Chagas' disease serology and PCR- based detection of Trypanosoma cruzi kinetoplast DNA in Bolivian children living in an endemic area. FEMS Microbiol.Lett. 124, 419-424.
Wincker, P., Britto, C., Pereira, J.B., Cardoso, M.A., Oelemann, W., and Morel, C.M. (1994). Use of a simplified polymerase chain reaction procedure to detect Trypanosoma cruzi in blood samples from chronic chagasic patients in a rural endemic area. Am.J.Trop.Med.Hyg. 51, 771-777.
Britto, C., Cardoso, M.A., Wincker, P., and Morel, C.M. (1993). A simple protocol for the physical cleavage of Trypanosoma cruzi kinetoplast DNA present in blood samples and its use in polymerase chain reaction (PCR)-based diagnosis of chronic Chagas disease. Mem.Inst.Oswaldo.Cruz. 88, 171-172.
Jones, E.M., Colley, D.G., Tostes, S., Lopes, E.R., Vnencak-Jones, C.L., and McCurley, T.L. (1993). Amplification of a Trypanosoma cruzi DNA sequence from inflammatory lesions in human chagasic cardiomyopathy. Am.J.Trop.Med.Hyg. 48, 348-357.
Breniere, S.F., Bosseno, M.F., Revollo, S., Rivera, M.T., Carlier, Y., and Tibayrenc, M. (1992). Direct identification of Trypanosoma cruzi natural clones in vectors and mammalian hosts by polymerase chain reaction amplification. Am.J.Trop.Med.Hyg. 46, 335-341.
Diaz, C., Nussenzweig, V., and Gonzalez, A. (1992). An improved polymerase chain reaction assay to detect Trypanosoma cruzi in blood. Am.J.Trop.Med.Hyg. 46, 616-623.
Murthy, V.K., Dibbern, K.M., and Campbell, D.A. (1992). PCR amplification of mini-exon genes differentiates Trypanosoma cruzi from Trypanosoma rangeli. Mol.Cell Probes. 6, 237-243. Russomando, G., Figueredo, A., Almiron, M., Sakamoto, M., and Morita, K. (1992). Polymerase Chain Reaction-Based Detection of Trypanosoma cruzi DNA in Serum. J.Clin.Microbiol. 30, 2864-2868. Solari, A., Venegas, J., Gonzalez, E., and Vasquez, C. (1991). Detection and classification of Trypanosoma cruzi by DNA hybridization with nonradioactive probes. J.Protozool. 38, 559-565.
Veas, F., Breniere, S.F., Cuny, G., Brengues, C., Solari, A., and Tibayrenc, M. (1991). General procedure to construct highly specific kDNA probes for clones of Trypanosoma cruzi for sensitive detection by polymerase chain reaction. Cell Mol.Biol. 37, 73-84.
Wincker, P., Roizes, G., and Goldenberg, S. (1990). Characterization of a Trypanosoma cruzi specific nuclear repeated sequence. Mol.Biochem.Parasitol. 41, 147-152.
Moser, D.R., Kirchhoff, L., and Donelson, J.E. (1989). Detection of Trypanosoma cruzi by DNA amplification using the polymerase chain reaction. J.Clin.Microbiol. 27, 1477-1482.
Gomes, M.L., Macedo, A.M., Vago, A.R., Pena, S. D.J., Galvao, L.M. and Chiari, E. “Trypanosoma cruzi: Optimization of polymerase chain reaction for detection in human blood.” Expl. Parasitol. 88, 28-33 (1998).
Wincker, P., Britto, C., Pereira, J.B., Cardoso, M.A., Oelemann, W. and Morel, C.M. “Use of a simplified polymerase chain reaction procedure to detect Trypanosoma Cruzi in blood samples from chronic chagasic patients in a rural endemic area.” Am. J. Trop. Med. Hyg. 51, 771-777 (1994).
Avila, H.A., Borges Pereira, J., Thiemann, O., DePaiva, E., Degrave, W., Morel, C., and Simpson,L., "Detection of Trypanosoma cruzi in blood specimens of chronic chagasic patients by polymerase chain reaction amplification of kinetoplast minicircle DNA: comparison with serology and xenodiagnosis." J. Clin. Microbiol. 31, 2421-2426 (1993).
Avila,H.A., Sigman,D.S., Cohen,L.M., Millikan,R.C. and Simpson, L., "Polymerase chain reaction amplification of Trypanosoma cruzi kinetoplast minicircle DNA isolated from whole blood lysates: diagnosis of chronic Chagas' disease." Mol. Biochem. Parasitol. 48, 211-222 (1991).
Avila, H., Goncalves, A., Nehme, N., Morel, C. and Simpson, L., "Schizodeme analysis of Trypanosoma cruzi stocks from South and Central America by analysis of PCR-amplified minicircle variable region sequences." Mol. Biochem. Parasitol. 42, 175-188 (1990).
Sturm, N., Simpson, L., Degrave, W. and Morel, C., "Sensitive detection and schizodeme classification of Trypanosoma cruzi cells by amplification of kinetoplast minicircle DNA sequences: Use in diagnosis of Chagas Disease." Mol. Biochem. Parasitol. 33, 205-214 (1989).
Degrave, W., Fragoso, S., Britto, C., Van Heuverswyn, H., Kidane, K., Cardoso, M., Mueller, R., Simpson, L. and Morel, C., "Peculiar sequence organization of kinetoplast DNA minicircles from Trypanosoma cruzi", Mol. Biochem. Parasitol. 27, 63-70 (1988).
Gomes, M.L., Galvao, L., Macedo, A., Pena, S. and Chiari, E., "Chagas disease diagnosis: Comparative analysis of parasitologic, molecular, and serological methods." Am. J. Trop. Med. Hyg. 60, 205-210 (1999).